Crohns logo Lowest Price
  Home | About Us | More Info | Articles | Archive | Product List | Store Map | SEARCH | Why Shop Crohns.net
Safe Shopping Guaranteed100% Secure     Call in Your Order Mon - Fri 9AM to 5PM PST1-877-240-7528 Contact Us by e-mail sales@crohns.net Have Questions. Check out Help!Help View items in your basket Basket

Product Ideas:


Dr Ohhira OMX 12+ Probiotics from Essential Formulas
Probiotic OMX 12 plus:
Dr Ohhira Award Winning probiotics Formula
resists staph aureus
Essential Formulas



Colostrum 4 Kids with probiotics from Child Life
Child Life
Colostrum 4 Kids
with probiotics



VSL3 Probiotic live lactic acid bacteria
VSL3# Probiotic
Clinical Trials
Help Ulcerative Colitis



DHA Junior Essential Fatty Acids from Nordic Naturals
Nordic Naturals
DHA Junior EFAs
essential fatty acids
great tasting for kids



The Great Physicians Rx book by Jordan Rubin from Garden of Life

The Great Physician's Rx

book by Jordan Rubin
7 Keys for Health & Wellness



Clear Energy mind and muscle adaptogen from Garden of Life products
Garden of Life products
Clear Energy
Mind and Muscle Adaptogen



A OK Laxative for constipation
A-OK
natural laxative
not habit forming



Clenzology Hygiene System from Maker's Diet by Jordan Rubin from Garden of Life
Garden of Life
Clenzology hygiene system from Makers Diet by Jordan Rubin



Breaking the Vicious Cycle book by Elaine Gottschall for scd diet
Breaking the Vicious Cycle
book by Elaine Gottschall
Specific Carbohydrate Diet (SCD)



Calmizen calm spray vitamins relax nerves and muscles
Spray Vitamins
Calmizen Calm Spray Vitamin:
soothe and relax muscles and nerves



Arthro-Spray relieve joint pain and build cartilage
Spray Vitamins
Arthro-Spray:
relieve joint pain and build cartilage

Anti-Bacterial Activity Of Probiotics Lactic Acid Bacteria Enterococcus Faecalis Th10 And Transduction Of Human Intestinal Tracts Cohesive Factor To E Faecalis Th 10

By: Dr Iichiroh Ohhira, Ph.D., October 2000

Currently, a large number of lactic acid bacteria utilized for live bacterial products are derived from human intestinal bacteria Enterococcus faecalis, one of the representative strains, has been utilized as live bacteria products with balancing activity, of intestines since the 1950s. The E. faecalis TH 10 used in this study was isolated from traditional fermented food "tempeh" in Malaysia, which main ingredients are soybeans. This strain does not produce hemolysin but shows protease activity more than six times in comparison to other ordinary lactic acid bacteria. Also, it revealed its characteristics of probiotics as acid-tolerance and anti-bacterial activity. In this study, the evaluation was based on an experiment conducted on E faecalis TH 10 as probiotics lactic acid bacteria and enforcement of cohesive factor to human intestinal tracts with a molecule breeding method. That is, after isolating and identifying anti-bacterial substance that E. faecalis TH 10 produces, cohesive activity of these bacteria to human intestinal tracts model Caco-2 cell was evaluated. Moreover, cloning of intestinal cohesive factors different from E. faecalis TH 10 from genome of Lactobacillus fermentum, other lactic acid bacteria showing high intestinal cohesive activity was conducted and the appearance of its gene on these bacteria was experimented.

Identification of anti-bacterial substance that E. faecalis TH 10 produces.

Lactic acid bacteria produce a variety of anti-bacterial substances, such as bacteriocin, and obtain inhibitive mechanism on growth of other microbes. Since E. faecalis TH 10 found phenomenon of showing anti-bacteria against Staphylococcus aureus, identification of anti-bacterial substance these bacteria produce was conducted. This substance was considered different from those already known.

METHODS: After inoculating these bacteria in MRS liquid medium (Oxoid), the bacteria was eliminated with centrifugal separation, its supernatant was extracted by water saturated butanol or ether, and fraction showing antibacterial activity in high speed liquid chromatography was obtained by reverse phase partition column. After methyl enducing it, isolation and identification were conducted by GC/MS with SPB-Octyl column (60m x 0.25mm- i.d.; Supelco).

RESULTS: As a result from analyzing by GC/MS, anti-bacterial substance, the bacterium produced was identified as phenyl lactic acid. By optical partition with optical isomer isolation column Nucleosil Chiral-1. found both types D and L in phenyl lactic acid obtained. They were forming racemic mixture. That is, although there is no report that lactic acid bacteria would produce phenyl lactic acid, it was admitted that these bacteria produce 13.4 u M of tvpe-D and 6.7 u M of type-L. 0.2% volume of DL-phenyl lactic acid inhibited the growth of entero hemorrhagic E Coli 0157:H7 and S. aureus completely in LB liquid medium (pH7.0).

Cohesive activity of E. faecalis TH 10 to human intestinal tracts model.

The reason why the most important character of probiotics lactic acid bacteria is said to be intestinal cohesive activity is that this characteristic relates profoundly to intestinal infection. For cohesive factors of infection, related bacteria are revealed already as lectin-like protein. S-layer protein lipoteichoic acid that exit in pilus and outer membrane: sugar protein, sugar lipid and out-of-cell matrix (ECM) protein as receptor on intestinal epithelial cell side. In lactic acid bacteria, also, since there are phenomena animal species which can stay in intestines are different by species and strains; strains set in intestines would change by aging, it is estimated that there exist factors coherent especially to animal cells. On studying cohesive activity of lactic acid bacteria to intestinal epithelial there has been utilized Caco-2, stated as ideal model cells on epithelial cells, or ECM protein, therefore, cohesive activity of E. faecalis TH 10 was investigated.

METHODS: Cohesive test to Caco-2 cells (Gram-stain method).

In culturing Caco-2 cells, we used DMEM medium containing fetal bovine serum which anfotelycin B and streptomycin-penicillin and anti-essential amino acid were applied. In order to make LAB-TEK chamber-slide, Caco-2 cells were inoculated and cultured in C02 incubator. Cell layers after culture was rinsed well with phosphorus acid buffer (PBS), added liquid where sample strains were suspended in a certain amount to DMEM medium and kept for 2 hours at 37 degrees C. After cleansing it with PBS twice. Gram-stained and counted cohesive bacterial count.

Cohesive test to Caco-2 cells (R1 label method)

First, sample strains were R1 labeled, as the same condition mentioned above, alter having them attached to Caco-2 cells rinsed and evaluated their settlement on base of count obtained in liquid scintillation counter.

Cohesive test to ECM protein

Laminin, type-I collagen, type-IV collagen, type-V collagen and bovine serum albumin (BSA) were immobilized to become 2.5pmol on a slide glass. After 2-hour blocking with 2% BSA/PB S. suspended liquid was dropped from each strain at 5 x 105ml concentration and left for 2 hours. After cleansing it with 0.1%BSA/PBS, Gram-stained cohered bacteria and counted cohesive bacterial count.

RESULTS: Cohesive activity of each sample strain to Caco-2 cells can be shown 23.2-6.0 at E. faecalis TH 10, cohesive bacterial count per 100 cells. The number was higher value than 18.0 - 4.3 of L. lactis subsp. lactis NIAI 527 that Kimoto et al 1998 reported with exclusive cohesive activity. Also, it was admitted that E. faecalis TH 10 obtains about 10% higher cohesive activity than E. coli with type-1 pilus.

Moreover, cohesive activity to four kinds of ECM protein: laminin, type-1 collagen, type-IV collagen, type-V collagen and bovine serum albumin, was investigated. Although they all varied strong and weak, it showed strong cohesive activity to especially, to type-IV collagen and showed higher value than L. crispatus JCM 5810. Therefore, it was clarified of validity to think that E. faecalis TH 10 is a strain with cohesive activity to human intestinal tracts.

Transduction of intestinal tract cohesive gene to E. faecalis TH 10.

When lactic acid bacteria have exclusive intestinal tracts cohesive activity, they are estimated to trigger antagonism inhibition of cohesive activity by pathogenic bacteria and to be utilized for prevention from infection and treatment after infected. Then, other intestinal tracts cohesive gene (sugar chain binding protein) was transducted to E. faecalis TH 10 and an experiment was made in aim to measure the increase of strength for cohesive activity by transduction. That is, in comparison to E. colt with type-I pilus, from L. fermentum FAF-1 with as high as 1.48-fold cohesive activity in above mentioned evaluation method- cloning was done on genes in relation to its cohesive activity, we produced these genes with E. faecalis TRIO and studied on possibility that it might have stronger cohesive activity to transformer obtained.

METHODS AND RESULTS:Cohesive activity of L Fermentum FAF-I with lectin-like protein was estimated and forward primer (CAYCARACNCAYTGGTAYATG) and rivers primer (ARYTCDGCYGDATCATCCA) from amino acid sequence of present lectin-like protein (Yamamoto, 1988) was assembled. By the way. above mentioned are multiple primers as Y:C or T R:A or G N:A or C or G or T D:A or G or T. L. fermentum FAF-I genome was PCR widened on template and obtained 370 by widened fragments. When decided the sequence. lectin-like protein gene of L. rhamnosus and 82% homology were admitted.

In order to conduct cloning of above gene. assembled genome library of L. fermentum FAF-1. First of all, genome was decomposed into 9 to 23 kb fragments with Sau3AI, conducted ligation to BAM HI of l DASH Il and obtained genome library. Having above 37bp by DNA sequence as prove, up to 3rd screening was done and obtained phage clone No.9-2-1 with lectin-like protein gene ORF from genome library. All DNA sequence integrated in this clone was decided.

Next, in order to conduct sub cloning to vector pIL253 for lactic acid bacteria of intestinal cohesive gene from L. fermentum, designed forward primer (GCGAATTCGTCTTCCACGACCAAGCACT) and rivers primer (CGCTCGAGTGGCCCTGAATCACGGTGTC) from sequence contained in phage clone No.9-2-1. PCR fragment widened from this primer was that contains ORF of intestinal cohesive gene from L. fermentum. Then settled respectively Eco RI site to forward primer and Xho I site to rivers primer. Both limited enzyme sites in this vector were integrated with its direction decided since multi cloning site of vector pIL253 for lactic acid bacteria have cleavage parts. After purifying and desalting this plasmid (p921EX), dissolved in 15 )u L sterilized distilled water and used it to electro poration method with gene pulser (Bio-Rad Laboratories) to E. faecalis TH10. It was confirmed that obtained erythromycin resistance transformer (Em1) plasmid was lectin-tike protein gene from L. fermentum with PCR method. And this protein was detected with antibody. Intestinal tracts cohesive activity of EM1 transformer of E. faecalis TI-110 where p921EX was transducted was evaluated by a testing method with RI labeled Caco-2 cells mentioned above. As a result, it was admitted that obtained transformer contains 1.83-fold higher cohesive activity than E.coli with type I pilus. In conclusion, by transducing intestinal cohesive gene of L. fermentum FAF-I to E. faecalis TH10, transformer 1.66-fold stronger than parent strain in intestinal tracts cohesive activity was successfully obtained.


Home | About Crohn's Disease | About Us | Product List | Search | More Info | Basket